Barcode DNA Sistem Identifikasi Mutakhir untuk Organisme

Document Details:
  • Uploaded: January, 11th 2015
  • Views: 451 Times
  • Downloads: 1 Times
  • Total Pages: 4 Pages
  • File Format: .pdf
  • File size: 283.71 KB
  • Uploader: Rosita Buana Putri
  • Category: Miscellaneous
 add to bookmark | report abuse
Warta Biogen Vol. 9, No. 2, Agustus 2013
2
Litbang Kementan memamerkan
video dan publikasi tentang sumber
daya genetik, tanaman transgenik,
dan Feromon. Informasi tersebut
ternyata sangat diminati oleh pe-
ngunjung untuk menambah wawas-
an, atau sebagai bekal peningkatan
kemampuan bertaninya. Feromon
yang kini banyak diminati oleh pe-
tani dipraktekkan dengan melihat
video Feromon. Video tersebut bisa
dimiliki oleh petani/kelompok tani
yang berminat. Pusat Perpustakaan
dan Penyebaran Teknologi Pertani-
an, di bawah Badan Litbang Per-
tanian, memfasilitasi pemberian
video tersebut secara gratis kepada
siapa saja yang menginginkan.
Hakteknas yang dibuka oleh
Menteri Riset dan Teknologi, Prof.
Dr. Ir. Gusti Muhammad Hatta, ini
mengandung banyak makna. Mak-
na untuk memamerkan hasil karya
anak bangsa kepada dunia luar,
dan makna perlunya sinergisitas an-
tar lembaga penelitian di Indonesia.
Dengan bekerja sendiri saja sudah
bisa sehebat itu, apalagi kalau se-
luruh lembaga penelitian tersebut
berkolaborasi meneliti sesuatu yang
bermanfaat bagi orang banyak. Ten-
tu hasilnya akan lebih hebat lagi.
Redaksi
ARTIKEL
ernahkah anda memperhatikan
seorang kasir di supermarket
mencatat harga barang ke dalam
komputer hanya dengan men-scan
label bergaris yang ada angka di
bawahnya menggunakan scanner
sederhana dan harganya langsung
muncul di layar monitor? Kode-
kode seperti itulah yang digunakan
supermarket untuk menandai se-
tiap barang. Barang yang telah di-
label dimasukkan dalam database
di komputer yang bisa diupdate
sewaktu-waktu sehingga tidak
mungkin tertukar. Cara/teknologi ini
membuat kasir lebih mudah dan
cepat dalam bekerja tanpa ada ke-
salahan. Teknologi pelabelan ini di-
kenal dengan nama barcode.
Barcode ditemukan pada ta-
hun 1949 oleh dua orang Amerika,
yaitu Bernard Silver dan Norman
Joseph Woodland. Meski barcode
telah dipatenkan pada 7 Oktober
1952, tetapi sistem barcode dengan
garis linier hitam-putih mulai digu-
nakan secara komersial lima belas
tahun kemudian. Dari beberapa sis-
tem barcode yang telah digunakan,
hanya Universal Product Code
(UPC) yang terdiri dari 12 angka
yang dipakai oleh banyak industri.
Barcode yang digunakan Indonesia
adalah sistem European Articles
Numbering (EAN) yang memiliki 13
digit yang terdiri dari 12 angka dan 1
cek digit. Semua produk berbar-
code diatur oleh menteri perda-
gangan dunia. Setiap negara memi-
liki kode barcode sendiri sehingga
tidak tertukar dengan negara lain.
Pada Gambar 1A terlihat bar-
code suatu produk makanan de-
ngan nomor kode 8991609119892.
Nomor 899 adalah kode barcode
untuk Indonesia (kode lain untuk
Indonesia adalah 888), nomor 1609
adalah kode perusahaan, sedang-
kan nomor 11989 untuk kode pro-
duk dan nomor 2 untuk validasi
atau cek digit. Tebal tipis dan hitam
putih garis-garis akan mudah dipin-
dai dengan alat scanner untuk me-
munculkan suatu deretan angka
barcode.
Penggunaan barcode sistem
linear ini tidak terbatas pada produk
yang terdaftar pada kementerian
perdagangan saja, tapi setiap orang
bisa membuat barcode sendiri un-
tuk keperluan tertentu. Misalnya,
barcode untuk produk segar seperti
ikan, sayuran, buah-buahan di su-
permarket. Barcode juga sudah
biasa digunakan untuk memberi
tanda barang-barang pada pener-
bangan dan memberi label suatu
percobaan.
Barcode DNA dan Aplikasinya
Atas dasar itulah para ilmuwan
saat ini tengah memikirkan cara
memberi kode suatu organisme hi-
dup dengan sistem barcode seperti
barcode pada produk buatan. Pada
produk buatan jauh lebih mudah
memberi kode angka karena pro-
duk tidak akan berubah dan selalu
P
Barcode DNA: Sistem Identifikasi Mutakhir
Gambar 1. Sistem barcode produk jadi dan mahluk hidup (http://www.google/barcode).
A
B
Warta Biogen Vol. 9, No. 2, Agustus 2013
3
terdaftar pada instansi yang berwe-
nang. Lain halnya dengan mahluk
hidup yang selalu berkembang biak
dan terjadi perkawinan, sehingga
individu satu akan berbeda dengan
individu lainnya walaupun masih
berada di dalam satu spesies. Pada
manusia, sidik jari tangan dapat di-
gunakan sebagai identifikasi
masing-masing orang, karena ber-
sifat unik dan tidak ada sidik jari
yang sama antar manusia. Namun,
sidik jari ini berlaku apabila manu-
sia tersebut masih hidup. Ketika
manusia mati, maka sidik jari ta-
ngan akan hilang. Oleh karena itu-
lah sidik jari yang tak pernah hilang
sepanjang waktu adalah sidik jari
DNA. Asumsi para ilmuwan adalah
masing-masing spesies (barangkali
nantinya masing-masing individu)
sebenarnya memiliki DNA yang unik
yang bisa digunakan sebagai pe-
nanda seperti barcode. Pada Gam-
bar 1B terlihat ilustrasi barcode
kupu-kupu dan burung berupa
garis-garis berwarna yang mewakili
basa nitrogen (AGTC) dengan urut-
an tertentu. Tentu saja untuk me-
mindahkan diperlukan alat scanner
yang lebih canggih dibandingkan
alat scanner barcode 13 digit angka.
Para ilmuwan yang berkecim-
pung di dalam ilmu taksonomi telah
menyadari perlunya identifikasi
suatu mahluk hidup menggunakan
DNA. DNA yang dijadikan barcode
harus unik untuk setiap spesies.
Pemberian barcode ini diharapkan
bisa membantu banyak orang seca-
ra cepat dan murah untuk menge-
nal suatu spesies dan seluruh infor-
masi yang terkait dengannya, dan
juga akan bisa secara cepat me-
ngenali penemuan jutaan spesies
lain yang belum dinamai. Sistem
barcode DNA ini diharapkan bisa
memonitor perubahan biodiversity
di dunia.
Penelitian barcode DNA ini me-
rupakan pekerjaan yang komplek,
dan tidak mungkin dilakukan oleh
satu instansi saja. Oleh karena itu
pada tahun 2003 dibentuklah
Consortium for the Barcode of Life
(CBOL). Konsorsium ini menga-
komodir hasil-hasil penelitian dari
anggota dan saling tukar informasi
yang terkait dengan kegiatan terse-
but. CBOL berpusat di National
Museum of Natural History,
Washington DC, Amerika Serikat.
Sampai saat ini CBOL telah berang-
gotakan sekitar 130 organisasi dari
43 negara. Namun sayang sekali
Indonesia tidak masuk sebagai ang-
gota konsorsium, padahal Indone-
sia termasuk salah satu negara de-
ngan biodiversitas yang kaya.
Bagaimana membuat barcode
mahluk hidup? Menurut petunjuk
dari CBOL ada empat komponen
yang diperlukan di dalam penelitian
barcode, yakni:
1. Spesimen: bisa berupa fosil, ja-
ringan beku, benih, dan lain-lain.
2. Laboratorium analisis. Di sini di-
butuhkan alat-alat untuk keperlu-
an isolasi DNA, PCR, dan elektro-
foresis.
3. Database. Database ini berupa
data-data yang sudah dikoleksi
dan bisa dicocokkan dengan
spesimen yang sedang dianalisis.
Di sinilah perlunya kerja sama
yang erat antara institusi antar
negara (di dalam CBOL) untuk
tukar informasi, agar diketahui
spesimen yang diteliti apakah
sudah terdaftar sebagai spesies
ataukah belum diketahui spesies
apa.
4. Data analisis. Kegiatan ini tentu
saja membutuhkan program dan
peralatan komputer yang handal.
Data molekuler yang telah dida-
patkan tentu saja harus bisa di-
cari kesesuaiannya dengan data-
base yang ada secara cepat dan
akurat.
Gambar 2 menunjukkan cara
pembuatan barcode DNA dan cara
aplikasinya di Korea Selatan. Spesi-
men diekstraksi DNA dan dilaku-
kan PCR dengan primer spesifik.
Data yang ada disimpan di dalam
pusat bank data dan dapat diguna-
kan untuk mengidentifikasi spesies
yang lain. Indonesia pun bisa me-
niru model seperti di Korea ini,
namun perlu manajemen pene-
litian yang lebih baik, karena me-
nyangkut banyak institusi. Setiap
lembaga yang terkait dengan itu,
misal LIPI, Badan Litbang Pertani-
an, Badan Litbang Kehutanan, dan
lain-lain bisa membentuk konsor-
sium barcode DNA khusus tanaman
Indonesia. Namun, sudah seyogya-
nya Indonesia harus masuk ke
dalam CBOL karena informasi ten-
tang barcode DNA akan terbuka
lebar di tempat tersebut. Informasi
yang sangat penting terkait dengan
primer-primer spesifik yang bisa di-
gunakan untuk membuat barcode
DNA dapat diperoleh di situ.
Primer Spesifik Barcode DNA
Peneliti yang berkecimpung di
barcode DNA menyadari bahwa di-
perlukan alat penanda yang seder-
hana dan bisa membedakan satu
spesies dengan spesies yang lain.
Pada penelitian DNA harus ada pri-
mer yang bisa membedakan secara
tegas dan jelas. DNA inti tidak ter-
lalu banyak variasi di antara spe-
sies. Misalkan DNA inti pada manu-
sia berbeda hanya 0,9% dengan
DNA simpanse, sedangkan DNA
mikrokondrianya berbeda 9%. Oleh
karena itu penyusunan barcode
DNA bukan berasal dari DNA inti,
tetapi DNA di luar inti.
Pada hewan, DNA mikondria
dijadikan dasar untuk penyusunan
barcode DNA, sedangkan pada ta-
naman oleh karena jumlah dan va-
riasi sekuen mitokondrianya relatif
kecil, maka DNA plastida (kloro-
plas) dijadikan dasar sebagai bahan
Warta Biogen Vol. 9, No. 2, Agustus 2013
4
membuat barcode DNA. Pada ja-
mur, gen-gen ribosomal RNA (SSU
rRNA) bisa dijadikan dasar pem-
beda (Stoeckle, 2003). DNA sebagai
barcode ini harus memiliki ukuran
yang pendek tapi memiliki variasi
yang tinggi antarspesies, dan harus
bisa mengakomodir 10-100 juta spe-
sies. Pada penelitian lebih detil ter-
nyata tidak seluruh sekuen mito-
kondria bisa dijadikan alat barcode.
Gen cytochrome c oxidase I (COI)
dapat digunakan sebagai dasar
pembeda antar binatang (Hebert et
al., 2003). Primer yang digunakan
akan menghasilkan produk sebesar
658 bp (LCO1490 5’-
GGTCAACAAATCATAAAGATATTGG
-3’ dan HCO2198 5’-TAAACTTCAGG-
GTGACCAAAAAATCA-3’). Produk
PCR inilah yang kemudian disekuen
untuk kemudian dilihat susunan
basa nitrogennya. Ternyata antar-
spesies pada hewan bisa dibedakan
dari perbedaan urutan basanya.
Apabila empat basa digunakan
sebagai dasar maka kemungkinan
jumlah spesies yang bisa dibedakan
sekitar 4
658
atau tidak terhingga.
Peluang untuk membuat barcode
DNA pada hewan sangat besar,
namun diperlukan kerja yang besar
karena harus bekerja pada jutaan
spesies yang ada di dunia.
Bagaimanakah penyusunan
barcode pada tanaman? Sistem bar-
code pada tanaman ternyata tidak
semudah yang dilakukan pada he-
wan. Setelah dilakukan penelitian
bertahun-tahun CBOL pada tahun
2009 menawarkan dua daerah pada
kloroplas yang bisa dijadikan dasar
untuk barcode tanaman, yakni
lokus rbcL dan matK. Penelitian itu
sendiri telah menyaring tujuh lokus
pada kloroplas menjadi hanya dua
lokus saja. Tujuh lokus tersebut
adalah atpF-atpH spacer, matK
gene, rbcL gene, rpoB gene, rpoC1
gene, psbk-psbl spacer, dan trnH-
psbA spacer. Primer-primer kedua
lokus utama tersebut dapat diper-
oleh di http://www.barcoding.si.
edu/. Namun, penggunaan primer-
primer tersebut masih bersifat
“trial” karena belum ada yang
benar-benar bisa membedakan an-
tar spesies tanaman. Hollingsworth
(2011) menawarkan primer tam-
bahan, yakni nuclear ribosomal
DNA transcribed spacer (nrDNA ITS)
untuk menambah keakuratan data.
Namun, beberapa peneliti meng-
khawatirkan adanya kontaminasi
dengan jamur karena nrDNA ITS
umumnya digunakan sebagai pem-
beda pada jamur (Schoch et al.,
2012). Peneliti barcode tanaman di
Cina melaporkan hanya 2-3% ter-
kontaminasi jamur dari sampel
yang digunakan. Penelitian barcode
pada tanaman ini masih berlang-
sung terus, dan diharapkan dalam
waktu tidak terlalu lama sudah di-
peroleh barcode DNA tanaman
yang akurat dan bisa membedakan
antarspesies tanaman.
Barcode DNA dan Perlindungan
Varietas Tanaman
Penelitian barcode tanaman ini
sampai saat ini baru bisa membe-
dakan antarspesies saja dan belum
ditemukan primer spesifik yang bisa
membedakan individu di dalam
satu spesies. Misal pada genus
Oryza L. terdapat 25 spesies dan
genus Capsicum terdapat 20-27 spe-
sies, maka barcode DNA tanaman
yang bisa dibuat hanya akan efektif
untuk membedakan antar ke-25
spesies padi dan 20-27 spesies
cabe. Oleh karena itu, barcode DNA
akan sulit dibuat untuk padi IR64,
Code, Ciherang, dan lain-lain yang
sama-sama masih satu spesies.
Teknologi yang dimiliki oleh dunia
saat ini hanyalah primer yang
menghasilkan sekuen yang bisa
membedakan antarspesies tanam-
an, bukan intra spesies. Barangkali,
seandainya barcode DNA tanaman
tersebut sudah lengkap, penelitian
selanjutnya akan diarahkan kepada
barcode DNA intra spesies, atau
bahkan antar individu tanaman.
Penelitian sidik jari DNA yang
terdapat dalam DIPA BB Biogen be-
berapa waktu yang lalu sebaiknya
diarahkan untuk membuat identitas
spesifik untuk tanaman yang popu-
ler di masyarakat, dan bukan di-
arahkan kepada pembuatan bar-
code DNA seluruh sampel yang di-
Gambar 2. Model penyusunan sistem barcode di Korea Selatan (http://www.google/barcode).
Warta Biogen Vol. 9, No. 2, Agustus 2013
5
analisis. Penelitian ini lebih mudah
dengan memilih satu varietas saja
sebagai “core” yang akan dibuat
identitas secara molekuler. Bebera-
pa varietas yang bisa dicoba untuk
dibuat identitas molekulernya
seperti padi Ciherang, mangga
Harumanis, dan tanaman lainnya
yang dianggap paling populer di
Indonesia. Namun, pekerjaan ini ju-
ga tidak mudah mengingat tanam-
an pembanding yang digunakan
masih dalam satu spesies, sehingga
kemiripan genom masih mungkin
terjadi. Hasil identifikasi molekuler
tersebut selanjutnya bisa dicatatkan
kepada instansi berwenang, seperti
Pusat Perlindungan Varietas Ta-
naman dan Perizinan Pertanian
(PPVTPP), di bawah Kementerian
Pertanian RI. Dengan tercatatnya
varietas elit tersebut di kantor
PPVTPP, maka negara lain tidak
bisa mengklaim varietas tersebut
miliknya. Seandainya Indonesia ber-
keinginan memberikan kontribusi
terhadap pembuatan barcode orga-
nisme hidup, akan lebih baik bila
menjadi anggota pusat barcode
organisme hidup (CBOL).
DAFTAR PUSTAKA
CBOL Plant Working Group. A DNA
barcode for land plants. PNAS
106(31):12794-12797.
Hebert, P.D.N., A. Cywinska, S. L. Ball,
and J.R. deWaard. 2003. Biological
identifications through DNA
barcodes. Proc. R. Soc. Lond. B.
270:313-321.
Hollingsworth, P.M. 2011. Refining the
DNA barcode for land plants. PNAS
108(49):19451-19452.
Schoch, C.L., K.A. Seifert, S. Huhndorf,
V. Robert, J.L. Spouge, C.A.
Levesque, W. Chen, and Fungal
Barcoding Consortium. 2012.
Nuclear ribosomal internal
transcribed spacer (ITS) region as a
universal DNA barcode marker for
fungi. PNAS 109(16):6241-6246.
Stoeckle, M. 2003. Taxonomy, DNA,
and the Barcode of life. BioScience
53(9):2-3.
Tasliah
alinitas merupakan salah satu
cekaman abiotik yang menjadi
masalah serius dalam produksi padi
di Indonesia. Luas lahan bersalini-
tas tinggi semakin luas dari tahun
ke tahun akibat naiknya permukaan
laut. Konsentrasi garam-garam ter-
larut yang berlebihan pada lahan
pertanian akan mengganggu proses
fisiologis tanaman dan dapat meng-
akibatkan penurunan produksi serta
kematian tanaman padi. Untuk
mengatasi permasalahan tersebut
rekayasa genetik dapat diterapkan
dengan menyisipkan gen yang ber-
peran meningkatkan toleransi ter-
hadap keracunan garam.
Rekayasa genetika pada level
faktor transkripsi merupakan stra-
tegi yang menjanjikan untuk me-
ngembangkan varietas padi toleran
salinitas. Hal ini disebabkan karena
kemampuan faktor transkripsi un-
tuk melekat pada promotor dari
gen-gen target dan berperan pen-
ting dalam meregulasi ekspresi gen-
gen target dengan cara meningkat-
kan atau menekan transkripsi gen
tersebut. Faktor transkripsi mempu-
nyai bagian-bagian spesifik yang di-
sebut domain, yang terdiri dari 2
domain, yaitu DNA binding domain
(elemen trans-acting) dan cis-acting
domain (Haake et al., 2002). Suatu
faktor transkripsi dapat mengontrol
ekspresi dari beberapa gen target
melalui pengikatan spesifik antara
elemen trans-acting dengan elemen
cis-acting pada masing-masing pro-
motornya (Nakashima et al., 2009).
Salah satu gen faktor transkripsi
yang telah dipelajari peranannya
untuk toleransi terhadap cekaman
abiotik adalah Dehydration
Responsive Element Binding tipe 1A
(DREB1A). Gen DREB1A pada Arabi-
dopsis telah dipelajari secara men-
dalam dan memiliki fungsi utama
untuk meningkatkan toleransi ter-
hadap titik beku. Gen ini juga me-
miliki peranan penting sebagai
faktor tanskripsi di dalam mengatur
respon tanaman dan menginduksi
gen-gen target yang berperan dalam
peningkatan toleransi terhadap ce-
kaman (Gambar 1). Produk gen
DREB1A akan menempel pada
daerah yang disebut dehydration
responsive element (DRE). Daerah
DRE mempunyai sekuen inti
A/GCCGAC dan telah diidentifikasi
sebagai elemen cis-acting yang ter-
dapat pada daerah promotor gen-
gen target dan berperan mengatur
ekspresi gen dalam merespon
cekaman (Fujita et al., 2007).
Penemuan gen DREB1A pada
Arabidopsis memberikan kesem-
patan yang sangat luas untuk mem-
perbaiki sifat toleran tanaman lain
terhadap cekaman abiotik pada
padi melalui pendekatan rekayasa
genetik. Teknik yang dapat diapli-
kasikan untuk perbaikan toleransi
terhadap salinitas melalui rekayasa
genetika adalah teknik over-
ekspresi gen DREB1A. Mekanisme
dari teknik ini adalah membuat
ekspresi gen DREB1A (bisa dari
jenis tanaman sama atau berbeda)
S
Gen OsDREB1A, Faktor Transkripsi untuk
Perbaikan Varietas Padi Toleran Salinitas
Tinggi